Journal of Psychiatry

Gen receptor serotonin 1-a profile and structural equation modeling's analysis on Bali society domestic violence

Annual World Congress on Psychiatry

February 16-17, 2023 | Webinar

Lely Setyawati Kurniawan

Udayana University, Indonesia

Scientific Tracks Abstracts: J Psychiatry

Abstract:

Research on aggressive behavior is significantly associated with a reduction in Serotonin central activity. Central and peripheral serotonergic 5-HT functions in humans are quite fluctuating depending on the environmental situation. Certainly, aggressiveness in individuals will be formed gradually, through several repeated experiences after going through various social conflicts. Domestic violence is a universal problem that is often overlooked because it is considered domestic affairs only. DV can occur by anyone, bring a long-term impact, including the risk of becoming the next perpetrator of violence. This study is to determine the profile of 5HT1-A serotonin receptor genes and models of domestic violence (domestic violence) in Balinese by analyzing Structural Equation Modeling (SEM). This cross-sectional study was conducted at General Hospital and the Integrated Services Center for Women and Children Empowerment in Bali, by analyzing the influence of aggressive behavior, life stress and emotional intelligence for domestic violence and continued with a blood test to see the profile of the gene receptor Serotonin 1-A by rs6295 promoter with the primer forward gen 5-HTR1A TGCACATGGTAAGTGTGTGAAT and reverse gen 5-HTR1A ATACCTGGAGTTGAACAGAAAATG. Conclusion: This study shows the contribution of serotonin 5HT1-A receptor polymorphism in individuals with DV history and certain DV model related to aggressive behavior, life stress event and emotional intelligence.

Biography :

Lely Setyawati Kurniawan is from Udayana University. She has been working as a doctor began in 1991 at Dr. T.C. Hillers Hospital in Maumere, Flores Island, East Nusa Tenggara, as a government officer in the region. In the field of the organization she joined various professional and humanitarian organizations. Her current parent organization is the Denpasar Branch PDSKJI, which is under the auspices of IDI Denpasar. For more than 10 years she have assisted various organizations engaged in women's empowerment and child protection, at the local, national and international levels, such as P2TP2A, LPA, PUSPA, ISPCAN and IAFMHS.