Research Article - (2018) Volume 9, Issue 4

Prevalence and Molecular Characterization of E. coli O157:H7 Isolated from Water Bodies in Ile-Ife and Environs

Christina Dunah Fashina1, Gbolahan Ola Babalola1 and Michael Omofowa Osunde1,2*
1Department of Microbiology, Obafemi Awolowo University, Ile-Ife, Nigeria
2Department of Soil Science Land Resource Management, Obafemi Awolowo University, Ile-Ife, Nigeria
*Corresponding Author: Michael Omofowa Osunde, Department of Soil Science Land Resource Management, Obafemi Awolowo University, Ile-Ife, Nigeria, Tel: +2348068997476 Email:

Abstract

Water is one of the crucial necessities of man since it is needed for almost all of his activities. With increase in population growth, quality water needed for consumption by man is on the decline because of environmental pollution. Thus the main aim of this study was to investigate the prevalence level of E. coli O157:H7 in water bodies in Ile-Ife and its environs which are the sources of water for man’s consumption. Four hundred and fifty-one samples were investigated from five major sources of water namely; well, stream, borehole, bottled and sachet. The water samples were screened for E. coli and serologically characterized for E. coli O157:H7. The E. coli O157:H7 isolates obtained were further characterized for stx 1, stx 2 and eaeA genes. The result revealed that well water and stream water had a prevalence of 8.74% and 4.59% respectively. Antibiotic resistance profile of E. coli isolates showed that both sources harboured isolates that are resistant to three classes of antibiotics. The virulence gene distribution shows that stx 1 and stx 2 were present in all the E. coli O157:H7 investigated. In conclusion, it appears that the gastroenteritis outbreaks experienced in the study area may be due to the presence of E. coli O157:H7 in water samples.

Keywords: E. coli O157:H7; Water quality; Virulence gene; Serology; Antibiotic resistance profile; Membrane filtration

Introduction

Water resources development around the world has taken many different forms and directions since the dawn of civilization. Humans have long sought ways of capturing, storing, cleaning, and redirecting freshwater resources. With the view of reducing their vulnerability to irregular river flows and unpredictable rainfall [1]. With the tremendous increase in both human population and activities, the quality of water has been on the decline. Groundwater stored beneath Earth’s surface in soil and porous rock aquifers accounts for as much as 33% of total water withdrawals worldwide [2]. In developing nations like Nigeria, the access to quality water is fast becoming a mirage due to poor infrastructural facilities, inappropriate farm practices as well as indiscriminate disposal of wastes. The release of human and animal wastes into water bodies both at the surface and underground has been reported to be the source of E. coli in the above listed water bodies [3]. The need for safe water which can also guarantee better life in both the rural and urban areas of the world has become a necessity.

Escherichia coli is a remarkable versatile bacterium whose presence has been established in water bodies including streams, rivers, wells and other sources of water [4,5]. Enterohaemorrhagic Escherichia coli O157:H7 was identified in 1982 as an important human pathogen causing haemorrhagic colitis and haemolytic uremic syndrome (HUS) and has been reported with increased frequency during the past decade as a cause of human illness [6-8]. The number of serotypes of vero-toxin-producing E. coli causing human disease is increasing, but E. coli O157:H7 continues to be the dominant cause of haemorrhagic colitis and HUS [6,9]. Findings have shown that very little information is available on E. coli O157:H7 in the study area as it pertains to water hence this study. The aim of this study was to investigate the prevalence of E. coli O157:H7 in Ile-Ife and characterize the isolates using molecular and antibiotic susceptibility testing techniques.

Study area

The study area of Ile-Ife and environs consisted of Ife Central Local Government (N 7°33’20”, E 4°30’15’’), Ife South Local Government (N 07°15’, E 04°30’13’’), Ife East Local Government (N 07°30’09’’, E 04°37’28’’) and Ife North Local Government (N 7°27’33’’, E 04°26’20’’) areas of Osun State in southwestern Nigeria. The inhabitants of these communities are traders, farmers, artisans and civil servants. The area under study is characterized by two seasons, i.e. rain and dry seasons. The temperature of the study area exists in the range of 30°C-38°C with an optimum of 35°C for the rain season while the temperature for the dry season is 25°C or less.

Materials and Methods

Sample collection

Well water collection: A total of one hundred and twenty (120) well water samples were collected from Ile-Ife and environs. The samples were from Sabo (Area Elevation: 935tF, Location: Latitude 07°29.470’ N, Longitude 024°33.341’ E), Ajebandele (Area: Elevation 853tF Location: Latitude 07°29.800’ N, Longitude 004°30.089’ E), Opa (Area: Elevation 883tF, Location: Latitude 07°31.350’ N, Longitude 004°34.482’ E) and Fajuyi (Area: Elevation 898tF, Location: Latitude 07°29.803’ N, Longitude 004°33.807’ E) areas. Water sample was collected aseptically from the wells into sterile bottles, kept on ice packs and transported to Microbiology laboratory (Obafemi Awolowo University, Ile-Ife) for processing using membrane filtration method [10].

Sachet water collection: A total of three hundred (300) sachet water samples were purchased randomly from fifteen brands commonly sold around Ile-Ife and environs (20 samples per brand) and transported to Microbiology laboratory (O.A.U., Ife) for processing using membrane filtration method [10].

Bottled water collection: A total of forty (40) bottled water samples from four (4) different brands were purchased at random and screened for E. coli O157:H7. They were bought at different locations around Ile- Ife and its environs and transported to Microbiology laboratory (O.A.U., Ife) for processing using membrane filtration method [10].

Borehole water collection: Borehole water samples were collected from 63 boreholes at seven different locations randomly chosen without any specific bias. Samples were collected at the taps directly connected to the water in the bore holes into sterile bottles, kept on ice packs and transported to Microbiology laboratory (O.A.U., Ife) for processing using membrane filtration method [10].

Culturing of water samples: Twenty millilitres (20 ml) each of the samples was withdrawn aseptically (using sterile 10 ml syringes) and passed through the membrane filter apparatus (pore size 0.22 μl) at room temperature (25°C-28°C) and under tap vacuum. After filtration, the membrane filters were then removed from the filter heads aseptically using sterilized forceps and carefully placed on moistened solid medium (SMAC) in Petri dishes. The plates were then incubated at 37°C for 24 h.

Biochemical characterization: The biochemical tests carried out include: Motility, Citrate utilization, Indole production, Methylred, Voges Proskeuer, Oxidase, Catalase, Hydrogen sulphide production, Urease production and growth on TSI agar slants. The results obtained from this biochemical characterization allowed for the identification of the isolates to species level.

Serological identification of isolates: Wellcolex E. coli O157:H7 kit (Remel Europe Ltd 30959601 ZC61 Danford) was used to determine the serological classification of the isolates.

Antibiotic susceptibility profile of isolates: The antibiotic susceptibility testing of isolates was determined by the disc diffusion method on Müller-Hinton agar (CM0337 oxoid, England) according to Bauer et al. [11] and interpreted in line [12]. The antibiotic disks (Mast Diagnostica Germany) and their concentrations (in μg) used include Ampicillin (10 μg), cephalothin (5 μg), colistin (25 μg), gentamicin (10 μg), streptomycin (10 μg), sulphatriad (200 μg), Tetracycline (250 μg), and cotrimoxazole (250 μg). The antibiotic disks were firmly placed on sterile Mueller-Hinton agar (MHA) plates previously seeded with a 24 h old culture of the isolate (106 CFU/ml of 0.5 McFarland Standard). The plates were incubated at 37°C for 24 h and diameters of zones of inhibition were compared [12]. Multiple antibiotic resistant (MAR) isolates were defined as resistance to greater than or equal to three (≥ 3) classes of the antibiotics tested. Plates were incubated at 37°C and the diameter of zone of growth inhibition was measured to the nearest millilitre and interpreted [12].

Molecular characterization of isolates: The DNA of the isolates were extracted by suspending 5-7 pure colonies of a 24 h bacterial culture on TSA agar plate in 500 μl of polymerase chain reaction (PCR) water and in Eppendorf tube. The bacterial suspension was boiled in a water bath at 100°C for 5 min and cooled to room temperature and mixed by gentle votexing. The tube was centrifuged at 12,000 rpm for 5 min. The DNA-containing supernatant were then transferred to another set of well labelled Eppendorf tubes and stored at -20°C until when needed.

Polymerase chain reaction (PCR) amplification of the genes: The PCR amplification of the genes was carried out using the primer sets (Table 1) specifically designed for the amplification of genes of interest. Amplification was carried out in a GeneAmp PCR system 9700 thermocycler (Applied Biosystem) following the traditional protocol of stepwise denaturation, followed by primer annealing step, extension step and a final holding at 4°C. The melting temperature (TM) of each primer set is specific. The PCR product was separated on a 1% agarose gel and 100 bp DNA ladder (Fermentas) was used as DNA molecular weight standard. Control positive and negative preparations were also included.

Target Gene Primer Sequence (5’-3’) PCR product size (bp) Number of cycles Denaturation Annealing Extension
Intimin 1 eaeA   233 35 94°C :30 s 56°C:30 s 72°C
Forward TGTCAGAGTGATGAAGGAGGG
Backward AACCAGTTCTTTGGCAGAGC
Intimin 2 EaeA   334 35 94°C :30 s 57°C:30 s 72°C
Forward TTGCTTCTGTTGATAACTCGGG
Backward GCTTGATACACCTGATGACTGTTC
Shiga toxin 1 Stx1   462 35 94°C :30 s 57°C:30 s 72°C
Forward (a) TCCAGAGGAAGGGCGGTTTA
Backward (a) ATCAGGCAGGACACTACTCAA
Stx1  
Forward (b) GTTACGGGAAGGAATCAGGGT 228 35 94°C :30s 57°C:30 s 72°C
Backward (b) AAACGCCACATAGACGAAGC
Shiga toxin 2 Stx2   228 35 94°C :30s 57°C:30 s 72°C
Forward (a) AAACGCCACATAGACGAAGC
Backward (a) GTTACGGGAAGGAATCAGGGT
Stx2   286 40 94°C :30 s 61°C:30 s 72°C
Forward (b) TTCTGCCACGAACTGACGGT 
Backward (b) AGCAACAGCGACATCATCCG
bfp gene Forward GGAAGTCAAATTCATGGGGGTAT 300 3 95°C : 5 min 55°C : 1 min 72°C
bfp gene Backward GGAATCAGACGCAGACTGGTAGT 300 3 95°C : 5 min 55°C : 1 min 72°C

Table 1: Primer sets used in the polymerase chain reaction (PCR) to detect shiga toxins (Stx1 and Stx2 ) and Intimin genes in the Escherichia coli isolates, O157:H7 and the PCR protocol conditions.

Results

A total of five hundred and seventy-one (571) samples were collected and cultured on Sorbitol MacConkey agar (SMAC). The samples were from well water (120), bottled water (40), borehole water (63), sachet water (300) and stream water (48). A total of four hundred and eighty (480) water samples were SF positive on EMB and one hundred and three (103) samples were SF negative (Table 2).

Water sources   Number of Samples SF on EMB NSF on EMB
Well  (4 areas) 120 (21.02%) 120 (25%) 57 (55.34%)
Sachet (15 brands) 300 (52.54%) 300 (62.5%) 0
Bottled (4 brands) 40 (7.01%) 5 (1.04%) 0
Borehole(7 locations) 63 (11.03) 7 (1.46%) 0
Stream (3 location) 48 (8.4) 48 (10%) 46 (44.66%)
Total 571 480 103

Table 2: Occurrence of SF and NSF bacterial isolates obtained from all the samples cultured from Ile-Ife and environs.

SF-Sorbitol fermenter; NSF-Non-sorbitol Fermenter; EMB-Eosin Methylene Blue Fifty-seven (57% and 55.34%) non-fermenters from well water were “O157” positive while forty-six (46% and 44.66%) from stream water samples were also “O157” positive isolates. Other sources of water examined did not yield any O157 isolates. Serotyping with the “H7” anti-serum resulted in 9 sero-positive isolates from well water and 5 (1.04%) from stream water (Table 2).

Discussion

A total of 480 isolates were sorbitol fermenters while 103 isolates were non-sorbitol fermenters. The prevalence level of NSF obtained from the various water sources used in this study showed that well and stream waters had 55.34% and 44.66%, respectively. Other sources namely sachet water, bottled water and borehole water did not contain the pathogen as shown in Table 3.

Water sources Number and % of samples Number of sero-positive E. coli O157 (%) Number of PCR (%) confirmed E. coli O157:H7
Well 120 (21.02%) 57 (55.34%) 9 (8.74%)
Sachets 300 (52.54%) 0 0 (0.0%)
Bottled 40 (7.01%) 0 0 (0.0%) 
Borehole 63 (11.03%) 0 0 (0.0%)
Stream 48 (8.4%) 46 (44.66%) 5 (4.59%)
Total 571 103 14

Table 3: Distribution of sero-positive E. coli O157: H7 Isolates from water samples obtained in Ile-Ife and environs.

Characterization with wellcolex for the different sero-groups showed that total of 103 sero-positive E. coli O157 investigated, 14 of the isolates were confirmed E. coli O157:H7 positive, indicating 8.74% prevalence for well water and 4.59% for stream water. The findings of 5.3% prevalence level in stream water but the 20% in well water in this study contrasted with that of Vieira et al. [13]. The higher level of prevalence of E. coli O157:H7 in well water may be due to the relative slow movement of water along the lateral plains in the soil substratum when compared with fast moving streams with even distribution. Studies on E. coli O157:H7 in water in southwestern Nigeria have been limited but in northern Nigeria [14], reported the presence of E. coli O157:H7 in river Kubanni suggesting that cattle excrement due to in situ herd watering and discharges from the abattoir were the major causes of its presence.

The antibiotic resistance pattern shows that the E. coli O157:H7 isolates obtained from well water were at least resistant to 2 different antibiotics and at most to 4 different types and stream water showed higher level of resistance with 4-5 different types of antibiotics resisted (Table 4). Overall, the total number of classes of antibiotics resisted were 4 (four), with well water and stream water being resistant to three classes of antibiotics (Table 5). The presence of these antibiotic resistant isolates in stream water may be due to fecal pollution from both man and animals and transformation, while well water may be due to poor hygiene, transformation and presence of the isolate in seepage water (Table 6).

Antibiotics (µg) Number and % of Resistant Isolates
Ajebandele (16) Fajuyi (09) Opa (13) Sabo (18) Stwa (15) Stwb (16) Stwc (15)
Cotrimoxazole  (250 µg) 0 0 0 0 0 0 1 (6.7%)
Ampicillin (10 µg) 0 0 3 (23.08%) 0 15 (100%) 16 (100%) 15 (100%)
Cephalothin (5 µg) 16 (100%) 9 (100%) 13 (100%) 18 (100%) 15 (100%) 16 (100%) 15 (100%)
Colistin (25 µg) 0 0 0 0 15 (100%) 16 (100%) 15 (100%)
Streptomycin (10 µg) 2 (12.5%) 0 0 0 0 0 0
Sulphatriad (200 µg) 0 0 13 (100%) 0 0 0 0
Gentamicin (10 µg) 0 1 (11.11%) 4 (30.77%) 0 0 0 0
Tetracycline (250 µg) 4 (25%) 4 (44.44%) 0 17 (94.44%) 15 (100%) 16 (100%) 15 (100%)

Table 4: Antibiotic resistance profile of Escherichia coli isolates obtained from untreated well water and stream waters. *The number of isolates (in brackets).

Sample (Number tested) Antibiotic resistant Antibiotic classes (MDR)
Well water
Well water (Sa 15) CF, T β-lact & Tet
Well water (Abd 16) CF, S, T β-lact, Am &Tet
Well water (Fa 09) CF, GM, T β-lact, Am & Tet
Well water (Op 13) CF, AP, GM, S β-lact, Am
Stream water
Stream A (Stwa 15) CF, AP, CO, T β-lact & Tet
Stream B (Stwb 16) CF, AP, CO, T β-lact & Tet
Stream C (Stwc 15) CF, AP, CO, TS, T β-lact, SP & Tet

Table 5: Multiple antibiotic resistant pattern of E. coli isolates from well and stream waters. Key: Stwa-Stream A; Stwb-Stream B; Stwc-Stream C; Tet-Tetracyclines; β-lact-Beta lactamase; SP-Sulfonomides; STSulphatriad (200 μg); TS-Cotrimoxazole (250 μg); AP-Ampicillin (10 μg); CF-Cephalothin (5 μg); CO-Colistin (25 μg); GM-Gentamycin (10 μg); S-Streptomycin (10 μg); T-Tetracycline (250 μg); Am- Aminoglycosides; MDR-Multi-Drug-Resistance.

Sample Frequency of O157:H7 Isolation No. of Strain with eaeA No. of Strain without eaeA No. of Strain with stx 1 No. of Strain withoutstx 1 No. of Strain with stx 2 No. of Strain without stx 2
Ww 9 (64.29%) 8 (61.54%) 1 9 (64.29%) 0 9 (64.29%) 0
Stw 5(35.71%) 5(38.46%) 0 5(35.71%) 0 5(35.71%) 0
Bhw 0 (0%) 0 (0%) 0 0 (0%) 0 0 (0%) 0
Sw 0 (0%) 0 (0%) 0 0 (0%) 0 0 (0%) 0
Bw 0 (0%) 0 (0%) 0 0 (0%) 0 0 (0%) 0
Total 14 (100%) 13 (92.86%) 1 (7.14%) 14 (100%) 0 (0%) 14 (100%) 0 (100%)

Table 6: Distribution of eaeA , stx 1 and stx 2 genes among strains isolated in samples. * Bw-Bottled Water; Sw-Sachet Water; Ww-Well Water; Bhw-Borehole Water; Stw-Stream Water.

Molecular characterization of the E. coli O157:H7 isolates for virulent genes indicated the presence of shiga toxin 1 (stx 1 ), shiga toxin 2 (stx 2) and intimin (eaeA ) genes in both well and stream waters. E. coli O157:H7 can cause HUS mainly by secretion of Shiga toxins encoded by the genes stx 1 and/or stx 2 and their variants [9,15]. It has been proposed as reported by that stx 2 has a lower receptorbinding affinity which enables it to stay longer in circulation and to reach the kidneys more easily than stx 1 . Shiga toxins can be released by antibiotics that may cause bacterial lysis and liberate the free Shiga toxins in the intestinal tract [16] or enhance the expression of shiga toxin genes [17,18].

Conclusion

The recent epidemic of diarrheal incidence among the people living in the study area, especially young children which are often times attributed to cholera may as well be associated with E. coli O157:H7. Therefore, for the proper treatment of gastroenteritis in the study area, there is the need for correct laboratory diagnoses before medication is administered to patients. This is to avoid the development of superbug that will be resistant to antibiotic.

References

Citation: Fashina CD, Babalola GO, Osunde MO (2018) Prevalence and Molecular Characterization of E. coli O157:H7 Isolated from Water Bodies in Ile-Ife and Environs. J Bacteriol Parasitol 9:340.

Copyright: © 2018 Fashina CD et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.