20+ Million Readerbase
Indexed In
  • Academic Journals Database
  • Genamics JournalSeek
  • Academic Keys
  • JournalTOCs
  • China National Knowledge Infrastructure (CNKI)
  • Scimago
  • Access to Global Online Research in Agriculture (AGORA)
  • Electronic Journals Library
  • RefSeek
  • Directory of Research Journal Indexing (DRJI)
  • Hamdard University
  • EBSCO A-Z
  • OCLC- WorldCat
  • SWB online catalog
  • Virtual Library of Biology (vifabio)
  • Publons
  • MIAR
  • University Grants Commission
  • Geneva Foundation for Medical Education and Research
  • Euro Pub
  • Google Scholar
Share This Page
Journal Flyer
Flyer image

Research Article - (2015) Volume 7, Issue 6

Phylogenetic Investigations on the Endosymbiotic Bacteria of Axinella donnani

Vimala A1,2*, Xavier Innocent B3 and Huxley VAJ1*
1Biotech Research Laboratory, Department of Zoology, Thiru. Vi. Ka. Govt. Arts College Tiruvarur-3, Tamil Nadu, India
2Department of Biotechnology, Indian Institute of Technology, Chennai 600036, Tamil Nadu, India
3PG and Research Department of Zoology, St. Xavier's College (Autonomous), PalayamKottai, Tirunelveli, Tamil Nadu, India
*Corresponding Author(s): Vimala A, Department of Biotechnology, Indian Institute of Technology, Chennai, Tamil Nadu, India, Tel: 044 2257 8280 Email:
Huxley VAJ, Biotech Research Laboratory, Department of Zoology, Thiru. Vi. Ka. Govt. Arts College Tiruvarur-3, Tamil Nadu, India, Tel: 04366 - 222463 Email:

Abstract

The present study focuses on the isolation of endosymbiotic bacteria from eight different types of sponges. The sponges were collected from the southern peninsular coast of India and identified as Sigmadocia carnosa, Ircinia fasciculate, Callyspongia diffusa, Zygomycale angulosa, Clathria vulpine, Clathria gorgonids, Phloeodictyon species and Axinella donnani. For the isolation of endosymbionts, the collected sponge species were cultured in three different media such as Nutrient agar media, Zobell marine agar and Zobell marine agar + sponge extracts. The sponge extracts supplemented media produced high bacterial growth than the other media. The sponge A. donnani recorded the highest bacterial counts. Of which, 13 endosymbiotic bacterial strains (ESB) of A. donnani were screened against common pathogenic bacteria. The strains ESB-3 and ESB-7 were identified to be potential strains exhibiting significant antibacterial property. The antibacterial activity was evaluated through testing against various shrimp pathogens (Vibrio esturiances, Vibrio alginolyticans, Vibrio harvae, Aeromonas hydrophila and Pseudomonas aerogenosa) as well as human pathogens (Streptococcus hemolyticus, Vibrio fisheri, Escherichia coli, Morgenella morgenii, and Bacillus cereus). The strains exhibited significant activity against all the shrimp and human pathogens. The unknown bacterial strain (ESB3 and ESB7) were identified using 16S rRNA gene technique to be Bacillus subtilis, Further, sequencing methodologies verified that the FASTA sequence of ESB3 contains 994 residues and that of ESB7 contains 1023 residues. The result so these findings are presented and elaborately discussed in the following paper.

Keywords: Nutrient agar media; Endosymbionts; Immunosuppressive; Shrimp

Introduction

Sponges (phylum Porifera) are the most primitive of the multicelled animals, that have existed for about 700–800 million years. Approximately 15000 sponges have been described in the world and most of them live in marine waters, only 1% of the species inhabits freshwater [1]. According to Thomas (1998), India has more than 5000 species of marine sponges. But only 486 species has been described and reported. The reported landing species are Callyspongia sp, Sigmadocia sp, Dendrilla nigra, Clathria gorgonoides and Axinella donnani. All these species contained potent biologically active secondary metabolites [2].

A wide range of bioactive metabolites have been found in about 5000 from 500 marine sponges, most of them are reported to be bioactive. Up to 2014, five compounds or natural semisynthetic analogues which originate from the sponges have been resolved for medicinal purposes, and 13 compounds are in clinical trial, mostly as anticancer drugs, and 100 compounds are under preclinical trial [3]. Marine organism based biologically active natural drugs are used to treat many dangerous diseases and help improve our immune system [4].

However, an increasing role has been played by sponge associated microorganisms (endosymbionts) in the production of antibiotics and other drugs for the treatment of serious diseases. The identified bioactive substances from the endosymbionts showed therapeutic activity like anticancer, antibacterial, antifungal, antiviral, antiprotozoal, anthelmintic, anti-inflammatory, immunosuppressive and antifouling activities and the active compound are classified into the chemical groups such as peptides, polyketides, alkaloids, phenazines, isoprenoids, indolocarbazoles, sterols, fatty acids, and terpenes [5-8]. Without the necessity of harvesting or cultivation of the sponge, large amounts of metabolites can be produced [9].

In recent years, many bioactive compounds have been extracted from various marine organisms like seaweeds, sea grass, tunicates, sponges, soft corals, sea hares, nudi branches and bryozoans etc. Among the isolated potential metabolites, those from sponges are the most predominant [10]. In spite of the successes in drug discovery these associated microbes have received very little attention. The difficulty in the search of metabolites from sponge associated marine organism is mainly due to their non-cultivability [11]. It was estimated that 99% of sponge associated bacterial endosymbionts are uncultivable under laboratory condition using available media [12].

The sponge microbial association is a topic of research for a long time. Sponges are host organisms for various symbiotic microorganisms that include: archaea [13], bacteria [14], cyanobacteria [11], microalgae [15] and other sponges [16]. According to Vacelet and Donadey, the associated microorganisms may constitute up to 40% of sponge body mass [17]. Perusal of literature indicated the relation of sponges with bacteria. The relationship between the sponge and microorganisms are complex and complicated. The complexity of these microbes induced the microorganisms to synthesize effective metabolites with vast biodiversity [18].

In the present study sponges were collected from the southern peninsular coast of India. Studies involving the screening, isolation and characterization of bioactive compounds from marine bacteria on a systematic scale remains unencroached on. In the present study we have taken efforts to isolate and characterize the bioactive potential of marine bacteria associated with selected sponges The antibacterial activity of the endosymbionts was determined against 10 pathogenic bacteria of Human and Shrimp. Results found that the sponge A. donnani produced potent antibacterial activity than the other organisms. For the identification of the associated bacteria the 16SrRNA sequencing was performed. These findings suggested that the identified strains belonged to Bacillus subtilis. The evolutionary relationship associated with the sponge A. donnani using sequence data was generated based on 16S rRNA and comparisons made with the help of databases through the BLAST programme.

Materials and Methods

Collection and identification of sponges

The ecofriendly catch method was followed for the collection of marine sponges at different locations of southern peninsular coast of India (Arokyapuram, Muttom and vizhinjam). The collected specimens were identified with the help of Dr. P.A. Thomas, Sponge Taxonomist, Scientist (Retd), CMFRI, Vizhinjam. The color, code and the collected places of sponges were tabulated in Table 1.

S. No. Sponge Color Code Collected places
1 Sigmadociacarnosa Brown MS-1 Vizhinjam
2 Ircinia fasciculate Brownish yellow MS-2 Vizhinjam
3 Callyspongiadiffusa Yellow MS-3 Vizhinjam
4 Zygomycaleangulosa Yellow MS-4 Arokyapuram
5 Clathriavulpina Brownish Yellow MS-5 Arokyapuram
6 Clathriagorgonids Reddish Yellow MS-6 Muttom
7 Phloeodictyon sp. Pink MS-7 Muttom
8 Axinelladonnani Black MS-8 Arokyapuram

Table 1: The collected sponges and their color, codes and collection spots.

Isolation of antibiotic producing endosymbiotic bacteria (APEB) from sponges

For the isolation of endosymbionts, the collected sponges were cultured in three different media such as Nutrient agar media, Zobell marine agar and Zobell marine agar + sponge extracts used as substrates. Initially, the separated sponge extracts were serially diluted with normal saline (NS) and streaked on the appropriate plates.

Quantitative analysis of endosymbionts

S. carnosa, I. fasciculate, C. diffusa, Z. angulosa, C. vulpina, C. gorgonides, P. sps and A.donnani (1 sq cm piece) were cultured in broth culture of nutrient agar + sponge extracts and Zobell marine agar + sponge extracts. The viable colonies were counted using pour plate method and the potent strain identified.

Antibacterial activity of endosymbionts

Test microorganisms: The antibacterial activity of the endosymbiont was determined against 10 pathogenic bacteria purchased from MTCC (Microbial Type culture collection), Chandigarh. The test organisms and their strain details are given in the Table 2.

S.No. Bacteria Gram stain
1 Micrococcus luteus  GRAM POSITIVE
2 Bacillus cereus GRAM POSITIVE
3 Bacillus subtilis GRAM POSITIVE
4 Staphylococcus aureus  GRAM POSITIVE
5 Staphylococcus epidermidis GRAM POSITIVE
6 Escherichia coli GRAM NEGATIVE
7 Proteus vulgaris GRAM NEGATIVE
8 Pseudomonas aeruginosa  GRAM NEGATIVE
9 Vibrio alginolyticus GRAM NEGATIVE
10 Aliivibriofischeri  GRAM NEGATIVE

Table 2: Test organisms.

Antibacterial assay: An agar-well diffusion method was employed for determination of antibacterial activities [19]. The Petri plates were prepared with 20 ml of sterile MHA. The plates were allowed to solidify for 5 minutes and the tested cultures were swabbed on top of the solidified media and allowed to dry for 10 min. Wells (4.6 mm in diameter) were cut from the agar with a sterile borer and 40 μl extract solutions were delivered into them. The extracts (well) were placed on the surface of medium and the compound was allowed to diffuse for 5 minutes and the plates were kept for incubation at 35°C for 24 hrs. Antibacterial activity was evaluated by measuring the diameter of inhibition zone. The zones of inhibition were measured in mm. Assay was carried out in triplicate and control plates were also maintained.

Sequencing and phylogenetic analysis of 16S rRNA gene

The DNA was extracted using the method as described by Chen and Kuo with slight modification and visualized on 1.0% agarose gel [20]. The 16S ribosomal DNA (rRNA) was amplified by PCR using 16SF: GAATCATATGCTGCGCCGTC and 16SR: ATCGGAACGCCATCCACTTC as primers. Thermal cycling was performed in an Applied BioSystem GeneAmp PCR system 2700 using Taq Polymerase (Fermentas) according to the following settings: initial denaturation at 94°C for 4 min; 35 cycles of 94°C for 1 min., 55°C for 1 min, and 72°C for 1 min; and a final extension at 72°C for 7 minutes. The PCR product after visualization was purified from the gel using PCR product purifying kit of Wizard SV Gel and PCR Cleanup System (Promega). The sequencing was performed by the DNA Sequencer ABI 3130 Genetic Analyzer (Applied BioSystems). The 16S rRNA sequence was compared to other prokaryotic 16S rRNA sequences by using the similarity search analysis service of NCBI (BLAST). For the construction of the phylogenetic tree and determination of the nearest database neighboring sequences, the sequences of isolates were aligned using CLUSTAL X program version 1.8 [21]. The sequences for the closest neighbors (approx. bp 1600) were used for the evolutionary study.

Results and Discussion

The South Peninsular coast was found to be an excellent area for the collection of marine sponges [22]. In, the present study, all the sponge species were collected from southern peninsular coast of India. The sponge species which were collected and used in the current study are shown in Figure 1. An earlier study by Sunil et al [23] showed that supplementing the media with sponge extract produced largest number of colonies in case of the sponge Tethya crypta associated microorganisms. The present study also clearly indicated that the sponge extract supplemented media produced more bacterial growth than the other media. Number of colonies produced on various media containing antibiotic producing endosymbiotic bacteria were shown in Table 3.

microbial-biochemical-technology-sponge-species

Figure 1: Sponge species.

Sponge species No. of colonies produced in various media
Nutrient agar Zobell marine agar Zobell marine agar + sponge extracts Total
S. carnosa 2 3 8 13
I.  fasciculate 2 3 4 9
C. diffusa 6 6 8 20
Z. angulosa 2 2 4 8
C. vulpina 2 2 5 9
C. gorgonids 2 2 3 7
P. sp. 2 2 4 8
A. donnani. 3 3 4 10

Table 3: Isolation of antibiotic producing endosymbiotic bacteria from sponges.

Among the eight isolated organisms S. carnosa, C. diffusa and A. donnani, produced predominant numbers of bacterial colonies in all culture media compared to the rest. Callyspongia diffusa a total of 20 bacterial strains were isolated: 6 on nutrient agar, 6 on zobell marine and 8 on Marine extract supplemented-agar. Likewise the total of bacterial strains in Sigmadocia carnosa is 13: 2 on nutrient agar, 3 on zobell marine agar and 8 on Marine extract supplemented-agar and A. donnani produced 10 strains: 3 on nutrient agar, 3 on zobell marine agar and 4 on Marine extract supplemented-agar. The quantitative analysis reported that the number of colonies produced in 1 cm2 area of sponge. The sponges S. carnosa, C. diffusa and A. donnani contained very thick bacterial population, while Nutrient agar + sponge extracts of both C. diffusa and A. donnani contained 9 and S. carnosa contained 7. Similarly Zobell marine agar + sponge extracts contained 9, 10 in S. carnosa, C. diffusa and 13 in A. donnani. The sponges S. carnosa, C. diffusa and A. donnani contained very high bacterial growth as Nutrient agar + sponge extracts of both C. diffusa and A. donnani contained 9 and S. carnosa contained 7. Similarly Zobell marine agar + sponge extracts contain 9, 10 in S. carnosa, C. diffusa and 13 in A. donnani. Among the three sponge species, A. donnani exhibited highest activity. Table 4 clearly indicated that the sponge extract supplemented media produced more bacterial growth than the other media.

Sponge species No. of colonies produced in 1c.m2 area of sponge
Nutrient agar + sponge extracts Zobell marine agar + sponge extracts
S. carnosa 7 9
I. fasciculate 5 5
C. diffusa 9 10
Z. angulosa 4 6
C. vulpine 5 6
C. gorgonids 6 5
P. sp. 6 8
A. donnani. 9 13

Table 4: Quantitative analysis of endosymbionts.

The sponges S. carnosa, C. diffusa and A. donnani contained very thick bacterial population as Nutrient agar + sponge extracts. C. diffusa and A. donnani contain 9 and S. carnosa contain 7 colonies. Similarly Zobell marine agar + sponge extracts contain 9 in S. carnosa, 10 in C. diffusa and 13 in A. donnani. Among the three sponge species, A. donnani produced potent activity. The sponge-associated antogonistic actinomycetes were isolated from two marine sponges (Dendrilla nigra and A. donnani) reported for potent biological activity [24]. In A. donnani, the predominant numbers of bacterial colonies were noted in the culture media than the others. The endosymbiotic bacterial strain (ESB) of A. donnani was tested against 10 bacterial cultures is shown in Table 5 and 6.

Bacteria Antibacterial Activity
Gram Positive Gram Negative
Micrococcus luteus Bacillus cereus Bacillus subtilis Staphylococcus aureus Staphylococcus epidermidis Escherichia coli Proteus vulgaris Pseudomonas aeruginosa Vibrio alginolyticus Aliivibriofischeri
ESB – 1 - + ++ - +++ ++ + - + ++++
ESB – 2 ++ ++++ - +++ - - ++ + +++ -
ESB – 3 +++ ++ ++ ++ ++ - ++++ - + ++
ESB – 4 - ++ + - + +++ - ++ - -
ESB – 5 + - +++ ++ - + - - - +
ESB – 6 ++ + - - +++ - + ++++ - -
ESB – 7 ++ ++ ++++ ++ + + + - - +
ESB – 8 ++++ - + + - ++ - + +++ +
ESB - 9 - + ++ ++ - - + ++ - +
ESB - 10 ++ + - + ++ +++ - - + -
ESB - 11 - ++ + - - - + ++ ++ +++
ESB - 12 - - - ++++ + + ++ +++ - -
ESB - 13 ++ ++++ + - - + +++ ++ - +

++++=30; +++=20-30mm; ++=10-20mm; +=1-10mm - = No Activity

Table 5: Antibacterial potential of endosymbiotic bacterial strain (ESB) of A.donnani against common pathogenic bacteria.

  Pathogens     Bacterial Species Zone diameter produced by ESB – 3 endosymbiont Zone diameter produced by ESB – 7 endosymbiont
20°C 37°C 20°C 37°C
Shrimp pathogens V. esturiances ++ + + +
V. alginolyticans ++ - + -
V. harvae + - - -
A. hydrophila ++++ ++ ++ +
P. aerogenosa +++ + + -
Human pathogens S. hemolyticus ++ - + -
V. fisheri + - - -
E. coli +++ + ++ -
M. morgenii ++ - + -
B. cereus + - - -

++++=30; +++=20-30mm; ++=10-20mm; +=1-10mm - = No Activity

Table 6: The antibacterial activity of potent endosymbiont (ESB- 3 and ESB-7) against shrimp and human pathogens.

Among the 13 tested organisms ESB-3 and ESB-7 showed highest activity. The Australian marine sponge, Axinella sp., possesses antibacterial activity against Helicobacter pylori [25]. The earlier report by Dhinakaran et al showed that the sponge associated strain of Echinodictyum gorgonoides was tested for its antibacterial activity against various human pathogens (E. coli, Proteus Spp, S. aureus, Pseudomonas and B. subtilis) and Annie et al [26] reported the antibacterial activity of A. donnani against fish pathogens (Aeromonas hydrophila, Pseudomonas aerug-inosa, Vibrio alginolyticus, V. anguillarum, V.fischeri, V. fluvialis, V. pelagius, and V. vulnificus) [27]. Many bacteria and cyanobacteria associated with sponges have been reported in the past to be the sources of antibiotics and other bioactive compounds in the marine environment reported a phenolic compound 2-(2,4-dib-romophenoxy)-4,6-dibromophenol was obtained from the sponge extracts of Dysidea granulose from Lakshadweep islands, against strains of MRSA and VRE [28]. In another study presence of phenolic compounds was confirmed by thin layer chroma-tography and associated Rf values of crude extract showed that the secondary metabolite was produced by endosymbiotic bacteria A. calcoaceticus in D. granulosa and was not from the sponge tissue [29]. Thus, the 2-(2, 4 -dibromophenoxy)-4,6-dibromo-phenol may be produced by the endosymbiotic bacteria of D. granulose. The suspected bioactive compounds include chemical entities such as peptides, polyketides, alkaloids, phenazines, isoprenoids, indolocarbazoles, sterols, fatty acids, and terpenes [5-8]. In the current study, although we have no conclusive evidence towards narrowing down on specifying any one such bioactive compound behind the observed antimicrobial activity, more studies are required in this direction for the isolation of these bioactive compounds. The present study also strongly supported the existing studies that A. donnani showed broad spectrum antimicrobial activity against 10 Human and Shrimp pathogenic bacteria.

16 S rRNA

Phylogenetic analysis based on 16SrRNA fragment is useful for understanding the basic relationship among strains [30]. The unknown strain of antagonistic bacteria associated with the sponge A. donnani is Rhodobacter sphaeroides and Rhodopseudomonas palustris [31]. Figure 2 represented the partial sequencing of 16SrRNA. It was reported that the unknown bacterial strains (ESB-3 and ESB-7) of the sponge A. donnani is Bacillus subtilis. The FASTA sequence of ESB3 contains 994 residues and ESB7 contains 1023 residues shown in Figure 3. The tree was constructed with the neighbor-joining method shown in Figure 4. Numbers on nodes indicate Bayesian posterior probability values. Genetic distances were computed by Kimura's two-parameter model. The 16S rRNA demonstrated that the identification of the unknown bacteria based on the ESB3 and ESB7 results pointed to Bacillus subtilis.

microbial-biochemical-technology-sequencing

Figure 2: 16SrRNA sequencing.

microbial-biochemical-technology-sequence

Figure 3: FASTA sequence of ESB3 and ESB7.

microbial-biochemical-technology-phylogenetic-analysis

Figure 4: Phylogenetic analysis of ESB3 and ESB7.

Conclusion

Eight different types of sponge species were collected from southern peninsular coast of India were found to high bacterial growth in sponge extract supplemented media. Among the eight isolated organisms S.carnosa, C. diffusa and A. donnani produced predominant numbers of bacterial colonies in all culture media. Comparatively, A. donnani, showed highest antimicrobial activity than the other 3 species. Based on the identification of potent endosymbiotic bacterial strain (ESB) of A. donnani against 13 common pathogenic bacteria ESB-3 and ESB- 7 were found to exhibit highest activity. The antibacterial activity of the potent endosymbiont (ESB- 3 and ESB-7) was determined against 5 shrimp and 5 human pathogenic bacteria. Further, the 16S rRNA partial sequencing reported that the unknown bacterial strains of ESB3 and ESB7 was Bacillus subtilis. The FASTA format sequences were used to construct the phylogenetic tree and it clearly indicated the evolutionary relationship between the species.

References

  1. Thomas PA (1998) Faunal diversity in India. Zoological Survey of India.
  2. Selvin J, Lipton AP (2006) Bioprospecting of Sponge Associated Microbial Endosymbionts, Brazil.
  3. Mayer AM, Glaser KB, Cuevas C, Jacobs RS, Kem W, et al. (2010) The odyssey of marine pharmaceuticals: A current pipeline perspective. Trends PharmacolSci 31: 255-265.
  4. Senthilkumar K, Kim SK (2013) Marine invertebrate natural products for anti-inflammatory and chronic diseases. Evid Based Complement Alternat Med 2013: 572859.
  5. Santos-Gandelman JF, Giambiagi-deMarval M, Oelemann WM, Laport MS1 (2014) Biotechnological potential of sponge-associated bacteria. Curr Pharm Biotechnol 15: 143-155.
  6. Abdelmohsen UR, Bayer K, Hentschel U (2014) Diversity, abundance and natural products of marine sponge-associated actinomycetes. Nat Prod Rep 31: 381-399.
  7. Valliappan K, Sun W, Li Z (2014) Marine actinobacteria associated with marine organisms and their potentials in producing pharmaceutical natural products. ApplMicrobiolBiotechnol 98: 7365.
  8. Armstrong E, McKenzie JD, Goldsworthy GT (1999) Aquaculture of sponges on scallops for natural products research and antifouling. J Biotechnol 70: 163.
  9. Thiel V, Imhoff JF (2003) Phylogenetic identification of bacteria with antimicrobial activities isolated from Mediterranean sponges. BiomolEng 20: 421-423.
  10. Donia M, Hamann MT (2003) Marine natural products and their potential applications as anti-infective agents. Lancet Infect Dis 3: 338-348.
  11. Rajeev Kumar Jha, XuZi – rong (2004) Biomedical Compounds from Marine organisms. Mar. Drugs 2: 123-146.
  12. Selvin J, Lipton AP (2006) Strategies for the Isolation and Cultivation of Sponge Associated Microbial Endosymbionts, Brazil.
  13. Lee EY, Lee HK, Lee YK, Sim CJ, Lee JH (2003) Diversity of symbiotic archaeal communities in marine sponges from Korea. BiomolEng 20: 299-304.
  14. Vacelet J, Kelly MA (2014) new species of Abyssocladia (Porifera, Demospongiae, Poecilosclerida, Cladorhizidae) and other carnivorous sponges from the far eastern Solomon Islands. Zootaxa 3815: 386-96.
  15. Asha Nair G, Selvakumar D, Dhevendaran K (2011) Occurrence of Sponges Associated Streptomyces and its Antimicrobial Activity. World Journal of Fish and Marine Sciences 3: 151-158.
  16. Wilcox T, P Hill M, DeMeo K (2002) Observations on a new twosponge symbiosis from the Florida Keys. Coral Reefs 21: 198-20.
  17. Vacelet J, Donadey C (1977) Electron-microscope study of association between some sponges and bacteria. J Exp Marine BiolEcol 30: 301-314.
  18. Rudolf Hausmann, Marco P, Vitello, Frank Leitermann, ChristophSyldatk (2006) Advances in the production of sponge biomass AplysinaaerophobaA model sponge for ex situ sponge biomass production, Journal of Biotechnology. 124: 117-127.
  19. Woods GL (1995) In vitro testing of antimicrobial agents. Infect Dis Clin North Am 9: 463-481.
  20. Chen WP, Kuo TT (1993) A simple and rapid method for the preparation of gram-negative bacterial genomic DNA. Nucleic Acids Res 21: 2260.
  21. Thompson JD, Gibson TJ, Plewniak F (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25: 4876-4882.
  22. Joseph Selvin, Lipton AP (2004) Biopotentials of secondary metabolites isolated from marine sponges, Hydrobiologia, 2004. 513: 231-238.
  23. Sagar S, Kaur M, Minneman KP (2010) Antiviral lead compounds from marine sponges. Mar Drugs 8: 2619-2638.
  24. Joseph Selvin, AronPremnath Lipton (2006) Strategies for the isolation and cultivation of sponge associated microbial Endosymbionts. Sponge Microbiology 258.
  25. Nechev J, Christie WW, Robaina R (2002) Lipid composition of the sponge Verongidaaerophoba from the Canary Islands. EurJLipid SciTechnol 104: 800-807.
  26. Annie Selva Sonia G, Lipton AP, Paul Raj R (2008) Antibacterial Activity of Marine Sponge Extracts against Fish Pathogenic Bacteria. The Israeli Journal of Aquaculture 60: 172-176.
  27. Dhinakaran ID, Ramakrishana D, Deva Prasad R (2012) Screening of marine sponge - associated bacteria from Echinodictyumgorgonoides and its bioactivity. African Journal of Biotechnology. 11: 15469-15476.
  28. Shridhar DMP, Girish BM, Vijayendra PK (2009) Antibacterial Activity of 2-(20,40 -Dibromophenoxy)-4,6-dibromophenol from Dysideagranulosa. Mar Drugs 7:464-471.
  29. Gopi M, Ajith Kumar TT, Balagurunathan R, Vinoth R, Dhaneesh KV, et al. (2012) Phylogenetic study of sponge associated bacteria from the Lakshadweep archipelago and the antimicrobial activities of their secondary metabolites. World J MicrobiolBiotechnol 28: 761-766.
  30. Cébron A, Coci M, Garnier J, Laanbroek HJ (2004) Denaturing gradient gel electrophoretic analysis of ammonia-oxidizing bacterial community structure in the lower Seine River: Impact of Paris wastewater effluents. Appl Environ Microbiol 70: 6726-6737.
  31. Rani Juneius CE, Selvin J (2012) Identification, phylogenetic characterization and preliminary screening of primary and secondary metabolites producing bacteria associated with marine sponge Axinelladonani. Indian J Drugs Dis 1: 1.
Citation: Vimala A, Xavier Innocent B, Huxley VAJ (2015) Phylogenetic Investigations on the Endosymbiotic Bacteria of Axinella donnani. J Microb Biochem Technol 7:318-322.

Copyright: © 2015 Vimala A, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.