Xylella fastidiosa is a gram-negative, xylem-limited plant pathogenic bacterium with a wide host range, especially in tropical and subtropical climates [1,2]. X. fastidiosa is the causal agent of a wide variety of diseases in economically important food and ornamental crops such as Pierce’s disease of grapevine, citrus variegated chlorosis, and leaf scorch diseases of almond, Japanese plum, elm, sycamore and oak [3-6]. Transmission of X. fastidiosa is via xylem-feeding leafhoppers, mainly the glassy-winged sharpshooter (GWSS), Homalidisca vetripennis. After transmission by the insect vector, X. fastidiosa colonizes and occludes the xylem vessels. Symptoms of Pierce’s Disease include scorching and necrosis of leaves, leaf blade drop, and dieback [2].

Three subspecies of X. fastidiosa have been described: X. fastidiosa subsp. fastidiosa, X. fastidiosa subsp. multiplex and X. fastidiosa subsp. sandyi [4,7]. Aside from the three defined subspecies, many strains of X. fastidiosa have also been described [2,5-10]. Colonization of the host by X. fastidiosa is not host-specific, but pathogenicity of X. fastidiosa exhibits a degree of host specificity. For example, X. fastidiosa subsp. fastidiosa is the only causal agent of Pierce’s disease of grapevine, but the subspecies has colonized over 28 monocotyledonous and dicotyledonous plants and been shown to be pathogenic on more than a few plant species [5,11,12]. Detection of the pathogen in non-grapevine hosts is difficult because the bacteria do not move systemically through the xylem vessels as they do in susceptible species. This leads to a lack of symptoms and low bacterial population levels in the non-systemic hosts. While no physical harm is caused to the plant, the asymptomatic host may act as a reservoir for the bacterium for later transmission to a susceptible plant host [2,13,14]. Spatial patterns of disease expression within infected vineyards indicate that sources near vineyards (such as riparian areas) serve as the primary source of inoculum for the pathogen [2,15-17]. This suggests that there is a breeding population of GWSS residing in the areas near infected vineyards [2]. Due to the likelihood that pathogen reservoirs are in plants with non-systemic infection and low X. fastidiosa population levels, it is imperative that diagnostic protocols of the subspecies are highly specific and capable of detecting low bacterial titers. Previous research has shown that, in most cases, PD vectors acquire and transmit only one X. fastidiosa subspecies although there have been incidences of GWSS acquiring multiple subspecies [18].

Prior to the classification of X. fastidiosa subspecies, X. fastidiosa was identified by a variety of techniques including: microscopy, culturing, enzyme-linked immunosorbent assay, standard polymerase chain reaction (PCR), RAPD fingerprinting and western blotting [18- 25]. Both microscopy and culturing are slow and relatively inaccurate methods for identification of X. fastidiosa and do not allow for identification of specific subspecies [12]. The other methods, while faster, lack established protocols for identification of X. fastidiosa subspecies.

Quantitative real-time PCR (qPCR) is a fast method by which high volumes of samples can be tested for presence or absence of X. fastidiosa subspecies [1]. Furthermore, this method can detect presence or absence of the pathogen in host tissue, even in cases where pathogen reservoirs are small [1]. In X. fastidiosa, the sequence of the 16s rRNA region is too highly conserved among subspecies to be useful for differentiation. Previous qPCR protocols used DNA melting temperature analysis (Tm) to differentiate X. fastidiosa subspecies by slight differences in the gyraseB gene sequence, which is a conserved housekeeping gene in subspecies. Although the method worked, melting temperatures of the amplicons tested were too similar to reliably discriminate X. fastidiosa subspecies [1].

SYBR® Green is a simple and commonly used dye for detection of DNA amplification in qPCR applications. It functions by binding to dsDNA and, upon binding, releases a fluorescent signal that is registered by the qPCR machine. The magnitude of this signal is relative to the concentration of dsDNA amplified [26]. The simplicity of SYBR® Green may explain why initial protocols we evaluated for X. fastidiosa subspecies differentiation exhibited high variance in Tm regardless of the source manufacturer. Since SYBR® Green indiscriminately binds to dsDNA and it may bind to primer dimmers, thus increasing the level of fluorescence and consequentially the Tm artificially. In this study, SYBR® Green from various manufacturers were compared and their reliability assessed.

The TaqMan® probe is a type of fluorescence resonance energy transfer (FRET) hybridization probe with a reporter and quencher to detect DNA amplification. The probe binds to the target sequence of the ssDNA during the annealing step and uses the DNA polymerase 5’-exonuclease activity to dissociate quencher and reporter. Once the reporter has dissociated from the probe and quencher, it is capable of fluorescing and being detected [26,27]. The Molecular Beacon® is another FRET probe consisting of a stem-loop structure with a quencher at the end of one stem and a reporter on the other. While in its free state, the molecular beacon forms a highly stable hairpin structure with the quencher and reporter adjacent to each other, allowing the quencher to completely eliminate the reporter signal. The molecular beacon unfolds via conformational switching during the annealing stage upon finding and binding to the complementary target sequence of ssDNA, which is a more stable conformation than the hairpin. When the molecular beacon is bound to the target sequence, the reporter and quencher are separated by the length of the target sequence, allowing sufficient separation for fluorescence data to be acquired [26,28]. Due to the stability of the molecular beacon in its free state, it is capable of discriminating between samples with as little as one nucleotide of difference.

In this study, previous SYBR® Green protocols for X. fastidiosa subspecies differentiation via Tm analysis were compared and analyzed using the gyraseB, tonB and zot1 gene regions with SYBR® Green, EVA Green® and Takara SYBR Green®. Initially, we were interested in determining whether the accuracy in SYBR Green based diagnostic protocols varied among different manufacturers or whether the variations is due to the nature of SYBR green itself. Based on the inconsistencies found in the melting temperature analysis, new protocols for differentiation were developed utilizing FRET probes in the zot1 gene region. The zot1 gene region appeared to be a good candidate for subspecies differentiation because it was conserved among all known X. fastidiosa subspecies and strains in the southwestern United States yet exhibited light variation [29]. Furthermore, we found that zot1 in X. fastidiosa subsp. multiplex has a unique insertion allowing it to potentially be easily differentiated from other subspecies. We chose not to use the 16s rRNA region or the conserved housekeeping gene gyraseB because these genes limited our options in developing diagnostic protocols due to the extremely high similarity among the X. fastidiosa subspecies.

X. fastidiosa strains and sample preparation

X. fastidiosa cultures were obtained from Dr. Lisa Morano at the University of Houston Downtown and colonies were collected from agar plates using a sterilized metal loop and placed into 100 μl of PBS buffer in a micro-centrifuge tube. Experimental X. fastidiosa isolates were obtained by collecting petiole samples from grapevines in Blanc du Bois and Black Spanish vineyards near a riparian area at Tara Vineyard in Athens, TX. Petioles were surface sterilized and crushed in 1 mL of PBS buffer in a grinding bag and 100 μl of the PBS buffer/ plant mixture was placed into a micro-centrifuge tube. Lysis Buffer L6 (5.25 M GuSCN, 50 mM Tris · HCl [pH 6.4], 20 mM EDTA, 1.3% [wt/ vol] Triton X-100) was prepared as previously described [30], and 100 μl was added to each sample, followed by centrifugation at 5000 rpm for 5 min. Next 53 μl of silica slurry was added, mixed and incubated at room temperature for 5 min, followed by 5 min of centrifugation at 2000 rpm. The supernatant was drawn off and discarded and 200 μl of wash buffer was added to each sample and centrifuged at 2000 rpm for 5 min. The wash step was repeated three times for a total of four washes. The samples were incubated at 60°C until the silica was dry. The dried sample was resuspended in 100 μl of TE Buffer (10mM Tris-HCl 1mM EDTA, pH 8.0), incubated for 5 min at 60°C, and centrifuged for 5 min at 5000 rpm. Afterward 70 μl of the supernatant was drawn off and stored at -20°C for later use.

qPCR and melt curve analysis

qPCR was conducted in 10 μl reactions consisting of 5 μl iQ™ Supermix (Bio-Rad Laboratories, Hercules, CA), 0.4 μl forward primer, 0.4 μl reverse primer, 1.0 μl nanopure water, 1.0 μl SYBR® Green nucleic acid gel stain (Molecular Probes™, Eugene, OR) and 2 μl sample DNA. The sample DNA consisted of X. fastidiosa subsp. fastidiosa, multiplex and sandyi from agar plate culture. Each reaction with sample DNA was carried out in triplicate. Two no-template-controls were included each time qPCR was conducted and consisted of 10 μl master mix. Eva Green® (Phenix Research Products, Candler, NC) and Takara SYBR Green® (Takara Bio USA, Mountainview, CA) were each switched with SYBR® Green nucleic acid gel stain for comparison. qPCR reactions were carried out in 0.1 mL PCR tubes in a Rotor-Gene RG-3000 qPCR machine (Corbett Research, St. Neots, Cambridgeshire, UK) with the primers shown in Table 1 under the following reaction conditions: 10 min at 95°C, 40 cycles of 30 sec at 95°C, 30 sec at 55°C and 1 min at 72°C; a final extensions of 10 min at 72°C and melt temperature analysis from 77°C to 90°C. All qPCR reactions were conducted a minimum of three times.

Table 1: Primers designed to amplify regions of the tonB and zot gene regions for Tm analysis of X. fastidiosa subspecies.

TaqMan® probe

Primers (Bioneer, Alameda, CA) and a TaqMan® Probe labeled at 5’-terminal nucleotide with a 6-carboxy-flourescin (FAM) reporter dye and at 3’-terminal nucleotide with Black Hole Quencher (BHQ- 1) (Sigma-Aldrich, St. Louis, MO) were designed based on the zot1 gene (GenBank Accession no. GQ891884) in X. fastidiosa subsps. multiplex and fastidiosa using Beacon Designer (Premier Biosoft International, Palo Alto, CA). qPCR was conducted in 10 μl reactions consisting of 5 μl iQTM Supermix (Bio-Rad Laboratories, Hercules, CA), 1 μl forward primer, 1 μl reverse primer, 0.6 μl nanopure water, 0.4 μl probe and 2 μl 5 ng/ul sample DNA. Each sample DNA reaction was carried out in triplicate. Sample DNA consisted of X. fastidiosa subsp. fastidiosa and X. fastidiosa subsp. multiplex from agar plate culture and qPCR was performed on a Bio-Rad iCycler (Bio-Rad Laboratories, Hercules, CA). X. fastidiosa subsps. multiplex specific protocol used forward primer Z1F (5’- CGTCAGACTACGCCAGATCA -3’) and Z1-2R (5’- GACGACCAATTAAACCGTGA -3’) with three different TaqMan probes: i403PFR (5’- (6-FAM) CGGTTTGGATTTTGTTTGGA (BHQ1) -3’), i396PFR (5’- (6-FAM) GTCATCGCGGTTTGGATTTT(BHQ1)-3’) and i399PFR (5’- (6- FAM) ATCGCGGTTTGGATTTTGT -(BHQ1)3’) under the following reaction conditions: 10 min at 95°C, 40 cycles of 30 sec at 95°C, 30 sec at 52°C and 1 min at 72°C. X. fastidiosa subsp. fastidiosa specific protocol used primers Z1F and Z1-2R with a TaqMan probe TqGB368 (5’- (6-FAM)TGTATGGACAACACAGCAAGC-(BHQ1)3’) under the following reaction conditions: 10 min at 95°C, 40 cycles of 30 sec at 95°C and 1 min at 60°C. All qPCR reactions with the TaqMan® probe were conducted a minimum of three times.

qPCR molecular beacon®

Primers (Bioneer, Alameda, CA) and a molecular beacon® labeled at 5’-terminal nucleotide with a FAM reporter dye and at 3’-terminal nucleotide with BHQ-1 (Sigma-Aldrich, St. Louis, MO) were designed based on the zot1 gene (GenBank Accession no. GQ891884) in X. fastidiosa subsp. multiplex and fastidiosa using Beacon Designer (Premier Biosoft International, Palo Alto, CA). qPCR was conducted in 10 μl reactions consisting of 5 μl iQTM Supermix (Bio-Rad Laboratories, Hercules, CA), 0.2 μl forward primer, 0.2 μl reverse primer, 2.5 μl nanopure water, 0.1 μl molecular beacon® and 2 μl 5 ng/ul sample DNA. Each sample DNA reaction was carried out in triplicate. Sample DNA consisted of X. fastidiosa subsp. fastidiosa and X. fastidiosa subsp. multiplex from agar plate culture and qPCR was performed on a Bio-Rad iCycler (Bio-Rad Laboratories, Hercules, CA). X. fastidiosa subsp. multiplex specific protocol used forward primer RMB307F ( 5’ - CGTCAGACTACGCCAGATCA - 3’) and reverse primer RMB536R (5’ - ATCCCATTCCCACAGATCAA -3’) with the R383MB (5’- (6- FAM) CGCGATCGCTGCCGAGCATCGTCATCGGATCGCG(B HQ1)-3’) molecular beacon® under the following reaction conditions: 10 min at 95°C, 40 cycles of 1 min at 95°C, 1 min at 57°C and 1 min at 72°C; a final extension of 10 min at 72°C and melt temperature analysis from 77°C to 90°C. Fluorescence signals were acquired during the annealing step (57°C). X. fastidiosa subsps. fastidiosa specific protocol used primers GMB487F (5’- ATGAGATGGTGGAGAATG -3’) GMB645R (5’- CACACAAAGGAATGAGAA -3’) with the molecular beacon® G580MB (5’- (6-FAM) CGCGATCGCTGCCGAGCATCGTCATCGGATCGCG (BHQ1)-3’) under the following reaction conditions: 10 min at 95°C, 40 cycles of 1 min at 95°C, 1 min at 56.2°C and 1 min at 72°C; a final extension of 10 min at 72°C and melt temperature analysis from 77°C to 90°C. Fluorescence signals were acquired during the annealing (56.2°C) step. All qPCR reactions were conducted a minimum of three times.

qPCR mixture series

Five sets of X. fastidiosa subsp. fastidiosa and multiplex DNA mixtures were prepared consisting of: 100% X. fastidiosa subsp. fastidiosa DNA, 80% fastidiosa & 20% multiplex, 50% fastidiosa & 50% multiplex, 20% fastidiosa & 80% multiplex, and 100% multiplex. The aforementioned mixtures were used as standards in qPCR and DNA were obtained from agar plate cultures, diluted to 5 ng/ul and reactions were carried out in triplicate. Experimental DNA samples (unknowns) were obtained from surface sterilized grapevine petioles as described and diluted to 5 ng/ul. Samples were subjected to qPCR with Takara SYBR Green® followed by qPCR with the molecular beacon® R383MB and primers RMB307F and RMB536R under previously described reaction conditions. All qPCR reactions were conducted a minimum of three times.

Analysis of current qPCR protocols and melt temperature analysis

Current qPCR protocols consist of using SYBR® Green to measure fluorescence of PCR products. After comparison of SYBR® Green to Eva Green® and Takara SYBR Green®, Takara SYBR green provided the most reliable results during melting temperature analysis (Table 2). Tm curve analysis with Takara SYBR Green® yielded results with lower error than either of the other two methods (0.02°C for Takara SYBR Green® vs. 0.03°C for SYBR Green® and 0.026°C for Eva Green®). The primers designed in the tonB gene region were not able to differentiate between the different X. fastidiosa subspecies using melt analysis (data not shown). T_m of samples tested resulted in large error, making discrimination of subspecies inaccurate. Primers in the zot1 gene region found considerable differentiation of the X. fastidiosa subspecies by T_m values of up to 0.5°C.

Table 2: Average Tm & error for differentiation of X. fastidiosa subspecies using three methods of fluorescence under ideal melt conditions with primers in Table 1.

TaqMan® probe and molecular beacon®

Dual-labeled TaqMan® probes designed to isolate X. fastidiosa subsp. multiplex worked with very limited success. A TaqMan® probe designed to isolate X. fastidiosa subsp. fastidiosa resulted in a wide variety of fluorescence data, with different subspecies often registering similar fluorescence data (data not shown). The molecular beacon® designed to isolate X. fastidiosa subsp. multiplex as well as X. fastidiosa subsp. fastidiosa provided clear and consistent differentiation of the two subspecies (Figure 1 and Figure 2). Furthermore, the X. fastidiosa subsp. multiplex molecular beacon allowed differentiation of samples with a slight mixture of the two subspecies (Figure 3). We were able to confidently tell that the X. fastidiosa subsp. multiplex sample was not pure if it contained less than 50% of the alternate sample type. With samples containing 50% or more of X. fastidiosa subsp. multiplex DNA, we were unable to differentiate them from a pure X. fastidiosa subsp. multiplex sample.

Figure 1: qPCR detection of X. fastidiosa subsp. multiplex. Fluorescence data acquired using molecular beacon® R383MB, specific for X. fastidiosa subsp. multiplex, with primers RMB307F and RMB536R under described reaction conditions.

Figure 2: qPCR detection of X. fastidiosa subsp. fastidiosa. Fluorescence data acquired using molecular beacon® G580MB, specific for X. fastidiosa subsp. fastidiosa, with primers GMB487F and GMB645R under described reaction conditions.

Figure 3: qPCR differentiation with mixed X. fastidiosa subspecies. Fluorescence data acquired using molecular beacon® R383MB, specific for X. fastidiosa subsp. multiplex, with primers RMB307F and RMB536R under described reaction conditions. Data shows differentiation X. fastidiosa subsp. multiplex and fastidiosa from mixed DNA samples. Reaction samples are A) X. fastidiosa subsp. multiplex, B) 50% X. fastidiosa subsp. multiplex, C) 20% X. fastidiosa subsp. multiplex, D) 100% X. fastidiosa subsp. fastidiosa.

For qPCR in general, Takara SYBR® Green provides a statistically more accurate and consistent method of measuring DNA amplification via fluorescence. Although more accurate, using only Takara SYBR Green® instead of the previously used SYBR Green® provides no significant advantage in identification of X. fastidiosa subspecies in an unknown sample. Furthermore, previously established protocols for identification of subspecies using T_m analysis do not provide the accuracy necessary to differentiate subspecies. A simple base inversion could cause a difference in T_m large enough (0.2 - 0.4°C) to cause all three subspecies to yield the same Tm, making them indistinguishable [1,31].

Takara SYBR Green® paired with a FRET probe is the best solution with current technology for rapid and accurate discrimination between subspecies. The TaqMan® probe did not yield reliable results. Either relative fluorescence units (RFU) were too low for the target subspecies, or the same in both subspecies. The X. fastidiosa subsp. multiplex specific TaqMan® probe bound indiscriminately to partial complementary sequences in X. fastidiosa subsp. fastidiosa. This occurs because the TaqMan® probe is more stable when bound to complementary ssDNA than when it is “free floating” in solution. The combination of generally low RFU for the target subspecies and incomplete binding to non-target DNA makes a TaqMan® probe based diagnostic protocol a poor choice.

Both the X. fastidiosa subsp. fastidiosa and multiplex molecular beacon® allowed for accurate and consistent discrimination of subspecies. Due to the highly stable hairpin conformation the molecular beacon® forms while “free floating”, sequences with only one base pair of difference may be successfully discriminated. The Molecular Beacons® developed were based on areas of the zot1 genome with 2-3 base pairs of variation between the subspecies. Therefore, a single base pair inversion will not cause one sample to be misidentified. Furthermore, the X. fastidiosa subsp. multiplex molecular beacon® differentiated samples of mixed subspecies, although once the sample contained 50% or more X. fastidiosa subsp. fastidiosa, the concentration of the target subspecies could not be quantified.

The new method of X. fastidiosa subspecies differentiation we developed will not only allow for rapid identification of X. fastidiosa in a host or vector, but it will also allow for rapid discrimination of subspecies. This is of increasing importance as prospective growers, especially of grapevines, attempt to plant susceptible crops in areas where there is no occurrence of X. fastidiosa. Without a complete knowledge of the numerous plant species that may act as reservoirs of the pathogen and breeding sites for the vector, it is increasingly important to be aware of pathogen presence prior to planting diseasesusceptible plants. Since many plant species that harbor the bacteria are symptomless and maintain low titers of bacterial populations, the only economically feasible solution with current technology is a qPCR diagnostic protocol. These protocols may further be used to identify and broaden our knowledge of asymptomatic hosts of X. fastidiosa. By detecting presence and subspecies of X. fastidiosa in a symptomatic or asymptomatic host with higher accuracy, lower cost and increased speed, more emphasis can effectively and rapidly be placed on disease avoidance at a minimal cost; thus minimizing the overall economic impact the disease has on the agriculture industries impacted by X. fastidiosa.

The authors of the manuscript have no conflict of interest with the research conducted and described above.

Funding for this project was provided by the Texas Pierce’s Disease Research and Education Program and USDA-APHIS. We would like to thank Cassie Skipper and Janet Arras for technical support in the laboratory.